View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_29 (Length: 358)
Name: NF0714_low_29
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 22 - 294
Target Start/End: Original strand, 51008384 - 51008660
Alignment:
| Q |
22 |
attcaccctctacacttcacctaccatagtaacagcctccaatatatatgcatataaacaagataatattcttgtgataattagttgcatcatgcttata |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51008384 |
attcaccctctacacttcacctaccatagtaacagcctccaatatatatgcatataaacaagataatattcttgtgataattagttgcatcatgcttata |
51008483 |
T |
|
| Q |
122 |
agacattcattggtataagcaactttgtttctacttgatttgcttagataatatttttgg----tataagctgttttatgtatgcatatgatctaaatat |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51008484 |
agacattcattggtataagcaaatttgtttctacttgatttgcttagataatatttttggtatatataagctgttttatgtatgcatatgatctaaatat |
51008583 |
T |
|
| Q |
218 |
tttgatgatgatgattcagttaactattgctgttatttaagcttattgtatgaatataaagaataaattctactgat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51008584 |
tttgatgatgatgattcagttaactattgctgtcatttaagcttattgtatgaatataaagaataaattctactgat |
51008660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 934 times since January 2019
Visitors: 4362