View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_33 (Length: 339)
Name: NF0714_low_33
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0714_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 25 - 316
Target Start/End: Complemental strand, 27234162 - 27233870
Alignment:
Q |
25 |
catcaccataacctttccaaaaccgaaaaaagagtgtcaacccattatttcgaagnnnnnnnnntgttaccattccaa-cagcagaaccataccaggaat |
123 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
T |
27234162 |
catcaccataacctttccaaaaccgaaaaaagagtgtcaacccattatttcgaagaaaaaaaaatgttaccattccaaacagcagaaccataccaggaat |
27234063 |
T |
 |
Q |
124 |
cattcactcaccatcattcacttctcagagattaattacatcatcactcaaaagcaaacatcatcactcttctacaagatctccaccatgtatgcaagat |
223 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27234062 |
cattcactcaccatcattcacttctctgagattaattacatcatcactcaaaagcaaacatcatcactcttctacaagatctccaccatgtatgcaagat |
27233963 |
T |
 |
Q |
224 |
taagggaccgaaattattatgaaagtcaaacatcatcaatcactctcccgcaaaatccagcatcaaaattcataaactcaaaaataatgatga |
316 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
27233962 |
taagggaccgaaattattatgaaagtcaaacatcatcaatcactcttctgcaaaatcaagcatcaaaattcataaactcaaaaataatgatga |
27233870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University