View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_35 (Length: 334)
Name: NF0714_low_35
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 50 - 310
Target Start/End: Complemental strand, 3284167 - 3283905
Alignment:
| Q |
50 |
taacatcatcaaaccattaaacaaaacaattaggaacataacatt-ataatttacaatgttt-aacaacttgtcagaatctatctaaatcagacaatttt |
147 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3284167 |
taacatcatcaaaccattaaacacaacaattaggaacataacatttataatttacaatgttttaacaacttgtcagaatctatctaaatcagacaatttt |
3284068 |
T |
 |
| Q |
148 |
gtttctcttgcttgccaattgagaagcttccaaacaagttgttttcaagttactactcaaattagggcactagtattaacacttagggtcttgctactac |
247 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3284067 |
gtttctcctgcttgccaattgagaagcttccaaacaagttgttttcaagttactactcaaattagggcactagtattaacacttagggtcttgctactac |
3283968 |
T |
 |
| Q |
248 |
acctagatcttctaaaagcatatattaaaaaataaacttccaaatggtatgtttgtattgatg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3283967 |
acctagatcttctaaaagcatatattaaaaaataaacttccaaatggtatgttcgtattgatg |
3283905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University