View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_39 (Length: 324)
Name: NF0714_low_39
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 23180220 - 23180545
Alignment:
| Q |
1 |
cgatgcacttttgctacaccattccacattgatatgtgcttggtacttcattagcaacgtagggttatatggtacaatatgtttgttattgagtgaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23180220 |
cgatgcacttttgctacaccattccacattgatatgtgcttggtacttcattagcaacgtagggttatatggtacaatatgtttgttattgagtgaaaca |
23180319 |
T |
 |
| Q |
101 |
ccattcttgacaattgtgttaccattgtctcttcgtctatacactggataaccttctttgtcaacaattgttgagttctgatacgtcttagggtagtatt |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
23180320 |
ccgttcttgacaattgtgttaccattgtctcttcgtctgtacaccggataaccttctttgtcaacaattgttgagttctgatacttcttagggtagtact |
23180419 |
T |
 |
| Q |
201 |
ttgtgcattttccatctttcatgcaaggtgat---------gataaaccacatggaccatggatcatatgatttttaaccaaattatacaactctttctc |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23180420 |
ttgtgcattttccatctttcatgcaaggtgatgatttatgagataaaccacatggaccatggatcatatgatttttaaccaaattatacaactctttctc |
23180519 |
T |
 |
| Q |
292 |
atgttcctgattgggtatctctgctg |
317 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
23180520 |
atgttcctgattgggtatctctgctg |
23180545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University