View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_42 (Length: 318)
Name: NF0714_low_42
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0714_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 97 - 229
Target Start/End: Complemental strand, 27508672 - 27508540
Alignment:
Q |
97 |
acaattctcagcacaaaactgttctatagcagcttcatcttgtttctgaattctccaaccatgttcttcagcaaaagccagcaatttctctttctgttcc |
196 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
27508672 |
acaattctcagcacaaaactgttctatagcagcttcatcttgtttctgaattctccaaccatgttcttctgcaaaagccagcaatttctctttctgttcc |
27508573 |
T |
 |
Q |
197 |
tgagtgaattttgttctgaatctcttccttgat |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
27508572 |
tgagtgaattttgttctgaatctcttccttgat |
27508540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 271 - 310
Target Start/End: Complemental strand, 27508498 - 27508459
Alignment:
Q |
271 |
gctactgctagggtttgacatatcatcatcatctctgctc |
310 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
27508498 |
gctactgctagggtttgacatatcatcatcttctctgctc |
27508459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 99 - 213
Target Start/End: Original strand, 46300716 - 46300830
Alignment:
Q |
99 |
aattctcagcacaaaactgttctatagcagcttcatcttgtttctgaattctccaaccatgttcttcagcaaaagccagcaatttctctttctgttcctg |
198 |
Q |
|
|
||||||||||||| || ||||| || ||| ||||||||| |||||||||||||| ||| || || ||||| || |||| || || || |||||||| |
|
|
T |
46300716 |
aattctcagcacagaattgttcaattgcaccttcatcttccttctgaattctccacccaattttctccgcaaatgcaagcatcttatccttttgttcctg |
46300815 |
T |
 |
Q |
199 |
agtgaattttgttct |
213 |
Q |
|
|
|||||||||||||| |
|
|
T |
46300816 |
cgtgaattttgttct |
46300830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University