View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_45 (Length: 305)
Name: NF0714_low_45
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 261
Target Start/End: Original strand, 6135206 - 6135453
Alignment:
| Q |
13 |
aatattgcacgatatagccttcaccttgaatcaatatgcatacatttaggtttgtataacttatttaatttaatgctcaacaaatcaataatgcaactga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6135206 |
aatattgcacgatatagccttcaccttgaatcaatatgcatacatttaggtttgtataacttatttaatttaatgctcaacaaatcaataatgcaactga |
6135305 |
T |
|
| Q |
113 |
aaattttagatgctgcattttcgtgtttacttagaatattttgcagtgaatacgtaaaacttgctaggatttcatgtatacnnnnnnnnnctctgttttg |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
6135306 |
aaattttagatgctgcattttcatgtttacttagaatattttgcagtgaatgcgtaaaacttgctaggatttcatgtatac-ttttttttctctgttctg |
6135404 |
T |
|
| Q |
213 |
gtgcacactgatgtcggtgattctgttgttgtaatagataaagatttcg |
261 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
6135405 |
gtgcactctgatgtcggtggttctgttgttgtatcagataaagacttcg |
6135453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 21 - 81
Target Start/End: Original strand, 6122081 - 6122141
Alignment:
| Q |
21 |
acgatatagccttcaccttgaatcaatatgcatacatttaggtttgtataacttatttaat |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
6122081 |
acgatatagccttcaccttgaatcaatatgcatacatttaggtttgtatgacttgtttaat |
6122141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 637 times since January 2019
Visitors: 4387