View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_5 (Length: 505)
Name: NF0714_low_5
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 290; Significance: 1e-162; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 93 - 497
Target Start/End: Original strand, 35484749 - 35485151
Alignment:
| Q |
93 |
ggtgggtggggttggagagcataatgagcgagctggaatccgacttgtataaggtgatacctacgactcaatattatttattataccggttcaaagcccc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
35484749 |
ggtgggtggggttggagagcataatgagcgagctggaatccgacttgtataaggtgatacctccgactcaatattat----tataccggttcaaagcccc |
35484844 |
T |
|
| Q |
193 |
catggccagccctcaacaattctgatgactgatgagcccccaaaacaaggtgagccccgagattttggtttgcacatgcgagatatagctttatttgtat |
292 |
Q |
| |
|
| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
35484845 |
taaggccagccctcaataattctgatgactgacgagcccccaaaacaaggtgagccccgagattttggtttgcacatgcgagttatagctttagttgtat |
35484944 |
T |
|
| Q |
293 |
ttgtttctctcacgtataga--nnnnnnnactattttgagtcgacgtgatttctgcaaccatgctccaattatctcgtgtcagtttgaagctcccaagca |
390 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| |||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35484945 |
ttgtttctctcacgtatagatttttttttagtattttgaggtgacgtgatttctacaatcatgctccaattatctcgtgtcaatttgaagctcccaagca |
35485044 |
T |
|
| Q |
391 |
tgagacttgaaagggcgaattcacgccttttagccaacatttgcttttcggtttctgattgacggttagatgttatcgtatctcgtttaagcacgtgttt |
490 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
35485045 |
tgagatttgaaagggcgaattcacaccttttagccaacatttgcttttcggtttctgattgacggctagatgttatcgtatctcgtttaagcacgtgctt |
35485144 |
T |
|
| Q |
491 |
tcttttc |
497 |
Q |
| |
|
||||||| |
|
|
| T |
35485145 |
tcttttc |
35485151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 895 times since January 2019
Visitors: 4357