View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_51 (Length: 284)
Name: NF0714_low_51
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 26074388 - 26074505
Alignment:
| Q |
1 |
gcaagcttactttgatgttgcaaaacaactatggattacgaaaaatggtatgctggaacgagaaattattgttatgcaatgtgtgaaatgaatctttcat |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26074388 |
gcaagcttactttgatgatgcaaaacaactatggattaagaaaaatggtatgctggaacgagaaattattgttatgcaatgtgtgaaatgaatctttcat |
26074487 |
T |
 |
| Q |
101 |
aaatagtatggtattgct |
118 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
26074488 |
aaatagtatgttattgct |
26074505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 1669315 - 1669198
Alignment:
| Q |
1 |
gcaagcttactttgatgttgcaaaacaactatggattacgaaaaatggtatgctggaacgagaaattattgttatgcaatgtgtgaaatgaatctttcat |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1669315 |
gcaagcttactttgatgatgcaaaacaactatggattaagaaaaatggtatgctggaacgagaaattattgttatgcaatgtgtgaaatgaatctttcat |
1669216 |
T |
 |
| Q |
101 |
aaatagtatggtattgct |
118 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
1669215 |
aaatagtatgttattgct |
1669198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 44273164 - 44273281
Alignment:
| Q |
1 |
gcaagcttactttgatgttgcaaaacaactatggattacgaaaaatggtatgctggaacgagaaattattgttatgcaatgtgtgaaatgaatctttcat |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44273164 |
gcaagcttactttgatgatgcaaaacaactatggattaagaaaaatggtatgctggaacgagaaattattgttatgcaatgtgtgaaatgaatctttcat |
44273263 |
T |
 |
| Q |
101 |
aaatagtatggtattgct |
118 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
44273264 |
aaatagtatgttattgct |
44273281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University