View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_53 (Length: 276)
Name: NF0714_low_53
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 59 - 132
Target Start/End: Original strand, 26586158 - 26586231
Alignment:
| Q |
59 |
ttgaaaactttaagtatatgggttggtgagtagcattaacaagttacagaatagtgaattttcacttacaagtc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26586158 |
ttgaaaactttaagtatatgggttggtgagtagcattaacaagttacagaatagtgaattttcacttacaagtc |
26586231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 197 - 235
Target Start/End: Original strand, 26586297 - 26586335
Alignment:
| Q |
197 |
gcagcaatggtatagtacctagtagttttgtttgatggg |
235 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26586297 |
gcagcaatagtatagtacctagtagttttgtttgatggg |
26586335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1241 times since January 2019
Visitors: 4365