View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0714_low_53 (Length: 276)

Name: NF0714_low_53
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0714_low_53
NF0714_low_53
[»] chr5 (2 HSPs)
chr5 (59-132)||(26586158-26586231)
chr5 (197-235)||(26586297-26586335)


Alignment Details
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 59 - 132
Target Start/End: Original strand, 26586158 - 26586231
Alignment:
59 ttgaaaactttaagtatatgggttggtgagtagcattaacaagttacagaatagtgaattttcacttacaagtc 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26586158 ttgaaaactttaagtatatgggttggtgagtagcattaacaagttacagaatagtgaattttcacttacaagtc 26586231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 197 - 235
Target Start/End: Original strand, 26586297 - 26586335
Alignment:
197 gcagcaatggtatagtacctagtagttttgtttgatggg 235  Q
    |||||||| ||||||||||||||||||||||||||||||    
26586297 gcagcaatagtatagtacctagtagttttgtttgatggg 26586335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University