View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_54 (Length: 270)
Name: NF0714_low_54
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_54 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 30 - 270
Target Start/End: Original strand, 28742480 - 28742720
Alignment:
| Q |
30 |
cattacactatttagtacataacagtatcaaatagcggctataatgacggtataacacttattgtgtagtggaattagaatgaaaatctatttttgcgat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28742480 |
cattacactatttagtacataacagtatcaaatagcggctataatgacggtataacacttattgtgtagtggaatttgaatgaaaatctatttttgcgat |
28742579 |
T |
|
| Q |
130 |
tcgcaattgacgacactgagtagcagctcccttgacttgcatcattcagtttgagtttagtgatattttatttaacagggaaatcagtaagttacaaaaa |
229 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28742580 |
tcgcaattgacaacactgagtagcagctcccttgacttgcatcattcagtttgagtttagtgatattttatttaacagggaaatcagtaagttacaaaaa |
28742679 |
T |
|
| Q |
230 |
gatgaacgataatatggtctctggatgaaaatgataacatt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28742680 |
gatgaacgataatatggtctctggatgaaaatgataacatt |
28742720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1176 times since January 2019
Visitors: 4365