View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_56 (Length: 264)
Name: NF0714_low_56
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0714_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 2 - 247
Target Start/End: Original strand, 48821205 - 48821454
Alignment:
Q |
2 |
ggagtgatactttcagttttagaaga----gagaggttgctagaacatgtccatttatttccttgtttgaaaactcatcgatgagcaatgcactaacaaa |
97 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48821205 |
ggagtgatactttcagttttagaagaaagagagaggttgctagaacgtgtccatttatttccttgtttgaaaactcatcgatgagcaatgcactaacaaa |
48821304 |
T |
 |
Q |
98 |
gttcaaatgcatcaggaaatcatacttgtggaaggccttaagctagatggcgtcccagcaggattatattccctcaattgcttgcctctcaggttggttg |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48821305 |
gttcaaatgcatcaggaaatcatacttgtggaaggccttaagctagatggcgtcccagcaggattatattccctcaattgcttgcctctcaggttggttg |
48821404 |
T |
 |
Q |
198 |
gttctgaggcatcaccaatacgatgtattctgatcggatgatgatgtcca |
247 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
48821405 |
gttctgaggcatcaccaatacgatgtattctgatcggatgatgaagtcca |
48821454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 150 - 228
Target Start/End: Original strand, 48833530 - 48833608
Alignment:
Q |
150 |
tcccagcaggattatattccctcaattgcttgcctctcaggttggttggttctgaggcatcaccaatacgatgtattct |
228 |
Q |
|
|
||||| ||||||||||||| || ||||||| ||||| |||||| |||| |||||| |||||||||| |||| ||||| |
|
|
T |
48833530 |
tcccaccaggattatattcagtccattgcttacctcttcggttggctggtgctgagggatcaccaataagatgcattct |
48833608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University