View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_61 (Length: 253)
Name: NF0714_low_61
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 5 - 234
Target Start/End: Complemental strand, 14185400 - 14185171
Alignment:
| Q |
5 |
tagttttaatcttgtctggttagcttatcttagtaaatagtagttttttcattgttttttatcttgcaaagtaaactggttgtcgtataattttttcttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14185400 |
tagttttaatcttgtctggttagcttatcttagtaaatagtagttttttcattgttttttatcttgcaaagtaaactggttgtcgtataattttttcttt |
14185301 |
T |
|
| Q |
105 |
aaatagtatttacacacatatatgtgatcatagtgaggggtaaggaggtatgctacacttgaaattgtgtagccttttgtatctatatatgattgggtac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14185300 |
aaatagtatttacacacatatatgtgatcatagtgaggggtaaggaggtatgctacacttgaaattgtgtagccttttgtatctatatatgattgggtac |
14185201 |
T |
|
| Q |
205 |
ctctgtattgcgtgaaggtatgatgatgtc |
234 |
Q |
| |
|
| || |||||||||||||||||||| |||| |
|
|
| T |
14185200 |
ccctatattgcgtgaaggtatgatggtgtc |
14185171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1000 times since January 2019
Visitors: 4362