View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_63 (Length: 253)
Name: NF0714_low_63
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_63 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 25 - 253
Target Start/End: Original strand, 52984224 - 52984452
Alignment:
| Q |
25 |
aataatgtgaacgttaatagatcttaaccgttcagaactaccaatacaattatttgaattgttgtgtctcttcaccaagtgacattaatttccatataaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52984224 |
aataatgtgaacgttaatagatcttaaccgttcagaactaccaatacaattatttgaattgttgtgtctcttcaccaagtgacattaatttccatataaa |
52984323 |
T |
 |
| Q |
125 |
agcagtatgacacacgaattttgcaacaattcaatttttctcccatttacaacattctaaatcgtcccccattactctgatgcatgagagaaatgtaggt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52984324 |
agcagtatgacacacgaattttgcaacaattcaatttttctcccatttacaacattctaaatcgtcccccattactctgatgcatgagagaaatgtatgt |
52984423 |
T |
 |
| Q |
225 |
atgaaacatatttttgtaaactattatca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52984424 |
atgaaacatatttttgtaaactattatca |
52984452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University