View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_65 (Length: 251)
Name: NF0714_low_65
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0714_low_65 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 121 - 251
Target Start/End: Original strand, 18656073 - 18656203
Alignment:
Q |
121 |
ttatccatgtcaaacctatgtctactacaaagcaacaccaccaaattacctcgatttagctaccatttcagaccttttccaacttagtcgtttaatgatc |
220 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18656073 |
ttatccatgtcaaacctatgtttactacaaagcaacaccaccaaattacctcgatttagctaccatttcagaccttttccaacttagtcgtttaatgatc |
18656172 |
T |
 |
Q |
221 |
tcaaaaccaagcaatatctcttcaccttctt |
251 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
18656173 |
tcaaaaccaagcaatatctcttcaccttctt |
18656203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1060 times since January 2019
Visitors: 4363