View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0714_low_65 (Length: 251)

Name: NF0714_low_65
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0714_low_65
NF0714_low_65
[»] chr5 (1 HSPs)
chr5 (121-251)||(18656073-18656203)


Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 121 - 251
Target Start/End: Original strand, 18656073 - 18656203
Alignment:
121 ttatccatgtcaaacctatgtctactacaaagcaacaccaccaaattacctcgatttagctaccatttcagaccttttccaacttagtcgtttaatgatc 220  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18656073 ttatccatgtcaaacctatgtttactacaaagcaacaccaccaaattacctcgatttagctaccatttcagaccttttccaacttagtcgtttaatgatc 18656172  T
221 tcaaaaccaagcaatatctcttcaccttctt 251  Q
    |||||||||||||||||||||||||||||||    
18656173 tcaaaaccaagcaatatctcttcaccttctt 18656203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University