View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_67 (Length: 251)
Name: NF0714_low_67
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 54 - 231
Target Start/End: Original strand, 36516112 - 36516295
Alignment:
| Q |
54 |
atttgtttagggtaaggatacaacagagccaaggtcgcgcgggagtaattataatatacctagtcgtggcggtggtggtggtaggactggtagtgaccga |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36516112 |
atttgtttagggtaaggatacaacagagccaaggtcgcgtgggagtaattataatataccgagtcgaggcggtggtggtggtaggactggtagtgaccga |
36516211 |
T |
|
| Q |
154 |
tatgctggcc------gtggtggcggtggtgcaagttcaaaccaattcagtaataatggtatgtttttcgaatctagatgatgt |
231 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36516212 |
tatgctggccgtggtggtggtggcggcggtgcaagttcaaaccaattcagtaataatggtatgtttttcgaatctagatgatgt |
36516295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 37
Target Start/End: Original strand, 36516071 - 36516100
Alignment:
| Q |
8 |
tattatgtattgtgcagagttagttacatg |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36516071 |
tattatgtattgtgcagagttagttacatg |
36516100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1078 times since January 2019
Visitors: 4363