View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_73 (Length: 247)
Name: NF0714_low_73
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_73 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 14977454 - 14977221
Alignment:
| Q |
1 |
cagtgtaacattacaaacatgttcaaacgttgttagaatcgaaaatagaatctaccaaagaagtaaaaattgaaacttttaaggttttgaagcatgccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14977454 |
cagtgtaacattacaaacatgttcaaacgttgttagaatcgaaaatagaatctaccaaagaagtaaaaattgaaacttttaaggttttgaagcatgccca |
14977355 |
T |
|
| Q |
101 |
ttctgttacctttgaaaaatttcgacgagttccaccttctagatccataacatgcgaggtttttgaagtttcaaagaaccatg-nnnnnnnngttttctg |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14977354 |
ttctgttacctttgaagaatttcgacgagttccaccttctagatccataacatgcgaggtttttgaagtttcaaagaaccatgtttttttttgttttctg |
14977255 |
T |
|
| Q |
200 |
gaacaaagaatttaaggtttttgttttgatgatg |
233 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
14977254 |
gaaccaagaatttaaggtttttgttttgatgatg |
14977221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 889 times since January 2019
Visitors: 4357