View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_75 (Length: 237)
Name: NF0714_low_75
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_75 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 81 - 142
Target Start/End: Original strand, 10655007 - 10655068
Alignment:
| Q |
81 |
gagtactagtttactaaccatgtttctggcatgcttgtataaatcattatcataagtagttg |
142 |
Q |
| |
|
||||||||||||| ||||||||||||||| || |||||||| |||||||||||||| |||| |
|
|
| T |
10655007 |
gagtactagtttattaaccatgtttctggtattgttgtataagtcattatcataagtggttg |
10655068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 10654711 - 10654758
Alignment:
| Q |
1 |
attggaaaaggttttgaggaacaagggattatttcggactgtgtaatt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||| ||||||||| |
|
|
| T |
10654711 |
attggaaaaggttttgaggaacaagggaatattttggattgtgtaatt |
10654758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 760 times since January 2019
Visitors: 4393