View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_8 (Length: 480)
Name: NF0714_low_8
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0714_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 2e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 125 - 271
Target Start/End: Original strand, 17355838 - 17355984
Alignment:
Q |
125 |
tcatatttgttttttgggcttatgtttcttgattttcttttaagaaagaacaagatcttgtattggtatggctaccattacaaatcttgtgggtcatatc |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
T |
17355838 |
tcatatttgttttttgggcttatgtttcttgattttcttttaagaaagaacaagatcttgtattggtatggctaccattacaaatcttatgggtcttatc |
17355937 |
T |
 |
Q |
225 |
tttcatttcttgatcaattgtcgtgaatcgttgattagatcgaacta |
271 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17355938 |
tttcatttcttgatcaattgtcgtgaatcgttgattagatcgaacta |
17355984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 16 - 66
Target Start/End: Original strand, 17355768 - 17355818
Alignment:
Q |
16 |
gatggacatcatcatcatgaaccccttcttcttcatattttcatcatctta |
66 |
Q |
|
|
|||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
17355768 |
gatggacatcttcatcatgaacctcttcttcttcatattttcatcatctta |
17355818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 97; Significance: 2e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 355 - 475
Target Start/End: Original strand, 4392396 - 4392516
Alignment:
Q |
355 |
tttctttctaagtgatgaaagccctagcattaacaccnnnnnnnnctctgccatctctgcaccaacaagattcctaattaagtccccagcatgtattctt |
454 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4392396 |
tttctttctaagtgatgaaagccctagcattaacaccttttttttctctgccatctctgcaccaacaagattcctaattaagtccccagcatgtattctt |
4392495 |
T |
 |
Q |
455 |
ttccttgttccctttgcttct |
475 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
4392496 |
ttccttgttccctttgcttct |
4392516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University