View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_84 (Length: 204)
Name: NF0714_low_84
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_84 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 40303816 - 40303636
Alignment:
| Q |
1 |
ccacaccttttgcatctcctctgggtttgagggtaccgacaagggataaggttggaaatgtcaaacaaattgaagaagagagaaagggtgcaaccacaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40303816 |
ccacaccttttgcatctcctctgggtttgagggtaccgacaagggatgaggttggaaatgtcaaacaaattgaagaagagagaaagggtgcaaccacaga |
40303717 |
T |
|
| Q |
101 |
tgataaggtgattttggaaatgtttaagcatactgaagaagatggaaaaaacaattttgttattccagtggatgttgatga |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40303716 |
tgataaggtgattttggaaatgtttaagcatactgaagaagatggaaaaaacgattttgttattccagtggatgttgatga |
40303636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 3 - 181
Target Start/End: Complemental strand, 8048310 - 8048132
Alignment:
| Q |
3 |
acaccttttgcatctcctctgggtttgagggtaccgacaagggataaggttggaaatgtcaaacaaattgaagaagagagaaagggtgcaaccacagatg |
102 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| || ||| ||||||||| ||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
8048310 |
acaccttttgcatctcctctaggtttgagggtaccgacgagtgatgaggttggaagtgtcaaacaaattgaagaagacataaagggtgcaaccacagatg |
8048211 |
T |
|
| Q |
103 |
ataaggtgattttggaaatgtttaagcatactgaagaagatggaaaaaacaattttgttattccagtggatgttgatga |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||| | |||||||||||| ||||||||||||| |
|
|
| T |
8048210 |
ataaggtgattttggaaatgtttaagcatactgaagaagatagaaataacgactttgttattccattggatgttgatga |
8048132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 3 - 128
Target Start/End: Original strand, 31635108 - 31635235
Alignment:
| Q |
3 |
acaccttttgcatctcctctgggtttgagggtaccgacaagggataaggttggaaatgtcaaacaaattgaagaagagagaaagg--gtgcaaccacaga |
100 |
Q |
| |
|
|||| ||||||||||| ||| ||||||||||||||||| || ||| ||||||||| ||||||||||||||||||||| || |||| ||||||||| ||| |
|
|
| T |
31635108 |
acacattttgcatctcttctaggtttgagggtaccgacgagtgatgaggttggaagtgtcaaacaaattgaagaagacaggaagggtgtgcaaccataga |
31635207 |
T |
|
| Q |
101 |
tgataaggtgattttggaaatgtttaag |
128 |
Q |
| |
|
|||| ||||||||| ||||||||||||| |
|
|
| T |
31635208 |
tgatgaggtgatttgggaaatgtttaag |
31635235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1320 times since January 2019
Visitors: 4368