View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0715_high_8 (Length: 283)
Name: NF0715_high_8
Description: NF0715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0715_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 29 - 170
Target Start/End: Complemental strand, 4275428 - 4275287
Alignment:
Q |
29 |
ataactttcactaccactactacagtcttttgttcttgtagcttgttctgtcttnnnnnnnnnnnnnnnnnngccacacacatcacacccaacagtctca |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
4275428 |
ataactttcactaccactactacagtcttttgttcttgtagcttgttctgtctttctctctcctctctctctgccacacacatcacacccaacagtctca |
4275329 |
T |
 |
Q |
129 |
gcattgttacagcaactgcaccactgcttcatctgttcctgc |
170 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4275328 |
gcattgttacagcaactgcaccactgcttcatctgttcctgc |
4275287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 237 - 283
Target Start/End: Complemental strand, 4275220 - 4275174
Alignment:
Q |
237 |
ccaatttttatattaattacaaagaaagtttagtttgatgatatccc |
283 |
Q |
|
|
||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
T |
4275220 |
ccaatttttatataaattacaaagaaagtttagtttaatgatatccc |
4275174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University