View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0715_low_10 (Length: 392)
Name: NF0715_low_10
Description: NF0715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0715_low_10 |
 |  |
|
| [»] scaffold0971 (1 HSPs) |
 |  |  |
|
| [»] scaffold0899 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0971 (Bit Score: 151; Significance: 8e-80; HSPs: 1)
Name: scaffold0971
Description:
Target: scaffold0971; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 791 - 601
Alignment:
| Q |
1 |
acctttgttatgcatactattctctcaaataggacaaagatgagatttcccgaacattcattactcacagcaataccaaaattaaatgctaatttgattc |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
791 |
acctgtgttatgcatactattctctcaaataggccaaagatgagatttcccgaacattcctcactcacagcaataccaaaattaaatgctaattcgattc |
692 |
T |
 |
| Q |
101 |
tgtgtgggattgacaaaccacacaatcatatggacagtcgacttgcttcttgtgcagccttgatccacttggtaaacaatctatcccaaga |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |||||| |||||||||||||| |||||||||| |
|
|
| T |
691 |
tgtgtgggattgacaaaccacacaatcatatggacagtcgacttgcttcctgtgtagctttgatctacttggtaaacaatatatcccaaga |
601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0899 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: scaffold0899
Description:
Target: scaffold0899; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 73 - 300
Target Start/End: Original strand, 1300 - 1526
Alignment:
| Q |
73 |
ataccaaaattaaatgctaatttgattctgtgtgggattgacaaaccacacaatcatatggacagtcgacttgcttcttgtgcagccttgatccacttgg |
172 |
Q |
| |
|
|||| |||| |||||||||||| ||||| || |||||| |||| ||| ||||| ||||| |||| |||||||| ||||||||||||||| |||| | |
|
|
| T |
1300 |
atacaaaaaataaatgctaattcaattctacgtatgattgaaaaacgacaaaatcagatggatagtcaacttgctttctgtgcagccttgatctacttag |
1399 |
T |
 |
| Q |
173 |
taaacaatctatcccaagactcctcgtaaaatgttttacgtttgcaggaatgtatataccaacggtttattcaaatcaccttttatgcgtcattcgcctc |
272 |
Q |
| |
|
|||||||||| |||||||| || ||||||||||||| |||| | ||||||||| ||| | ||||||||||||||||||| | | |||||| ||| |
|
|
| T |
1400 |
taaacaatctctcccaagaagccaaataaaatgttttacctttggaagaatgtatagaccga-agtttattcaaatcacctttaacacatcattcatctc |
1498 |
T |
 |
| Q |
273 |
tattaataatatgatcaacacactgatg |
300 |
Q |
| |
|
||||||||||| ||||||| |||||||| |
|
|
| T |
1499 |
tattaataatacgatcaacgcactgatg |
1526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University