View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0715_low_25 (Length: 275)
Name: NF0715_low_25
Description: NF0715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0715_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 22796062 - 22795813
Alignment:
| Q |
1 |
tcacgcattggctgcaaatggaacaggttccagaactttttacctagattgaacagattaatcttcaaactcaagatttgataacagggaaatattttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22796062 |
tcacgcattggctgcaaatggaacaggttccagaactttttacctagattgaacagattaatcttcaaaatcaagatttgataacagggaaatattttga |
22795963 |
T |
|
| Q |
101 |
actattttcctatctactaatatttattatacaggttaaatattcatgaaatgaattgtagataataacatagtgtgacattgac----tatcttgtaaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22795962 |
actattttcctatctactaatatttattatacaggttaaatattcatgaaatgaattgtagataataacatagtgtgacattgactatatatcttgtaaa |
22795863 |
T |
|
| Q |
197 |
agtttcatcattggaatactaaaaagcataccactctttgtatagttaat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22795862 |
agtttcatcattggaatactaaaaagcataccactctttgtatagttaat |
22795813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1338 times since January 2019
Visitors: 4368