View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0715_low_28 (Length: 251)
Name: NF0715_low_28
Description: NF0715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0715_low_28 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 6 - 251
Target Start/End: Complemental strand, 22796366 - 22796121
Alignment:
Q |
6 |
ctccaataatatactgtacctctccctattaaacataaaaggaaaattgaaacaagttaaccttagtttctgtggtaaatggaaaataacatactacata |
105 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
22796366 |
ctccaataaaatactgtacctctccctattaaacataaaaggaaaattgaaacaagttaacctttgtttctgtggtaaatggaaaataacatactacata |
22796267 |
T |
 |
Q |
106 |
cggagcaccgacatagacatggacaccaggcacgacaatgtcaataacaccgacatgcagacaccagttataatttgacaaagtggaagcaaatgaatga |
205 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22796266 |
cggagcaccgacatagacatggacaccaggcacgacaatgtcaataacaccgacatgtagacaccagttataatttgacaaagtggaagcaaatgaatga |
22796167 |
T |
 |
Q |
206 |
tgtaaccactagtgtgtcatgtctgcgtcggacatattgattgggt |
251 |
Q |
|
|
|||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
T |
22796166 |
tgtaaccactagtgtgtcatgtctctgtcggacacattgattgggt |
22796121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University