View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0715_low_30 (Length: 221)
Name: NF0715_low_30
Description: NF0715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0715_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 30079242 - 30079124
Alignment:
| Q |
1 |
ttcttcgctgccggtaaaaacagaagcttattcccccaatccgtttcttcctcagacaatctcctaaaatcccatgttatccttcccgcaacaagaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30079242 |
ttcttcgctgccggtaaaaacagaagcttattcccccaatccgtttcttcctcagacaatctccgaaaatcccatgttatccttcccgcaacaagaaaat |
30079143 |
T |
 |
| Q |
101 |
gatccttcccattgatgat |
119 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
30079142 |
gatccttcccattcatgat |
30079124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 13 - 113
Target Start/End: Original strand, 39485917 - 39486017
Alignment:
| Q |
13 |
ggtaaaaacagaagcttattcccccaatccgtttcttcctcagacaatctcctaaaatcccatgttatccttcccgcaacaagaaaatgatccttcccat |
112 |
Q |
| |
|
|||||||||| ||||||||| |||||||| |||| |||||| |||||||||||||||||| || ||||| || ||||||||||||||||| |||||| |
|
|
| T |
39485917 |
ggtaaaaacaaaagcttattaccccaatctttttcatcctcactcaatctcctaaaatcccaagtaatcctaccagcaacaagaaaatgatctctcccat |
39486016 |
T |
 |
| Q |
113 |
t |
113 |
Q |
| |
|
| |
|
|
| T |
39486017 |
t |
39486017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University