View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0715_low_30 (Length: 221)

Name: NF0715_low_30
Description: NF0715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0715_low_30
NF0715_low_30
[»] chr1 (1 HSPs)
chr1 (1-119)||(30079124-30079242)
[»] chr7 (1 HSPs)
chr7 (13-113)||(39485917-39486017)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 30079242 - 30079124
Alignment:
1 ttcttcgctgccggtaaaaacagaagcttattcccccaatccgtttcttcctcagacaatctcctaaaatcccatgttatccttcccgcaacaagaaaat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
30079242 ttcttcgctgccggtaaaaacagaagcttattcccccaatccgtttcttcctcagacaatctccgaaaatcccatgttatccttcccgcaacaagaaaat 30079143  T
101 gatccttcccattgatgat 119  Q
    ||||||||||||| |||||    
30079142 gatccttcccattcatgat 30079124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 13 - 113
Target Start/End: Original strand, 39485917 - 39486017
Alignment:
13 ggtaaaaacagaagcttattcccccaatccgtttcttcctcagacaatctcctaaaatcccatgttatccttcccgcaacaagaaaatgatccttcccat 112  Q
    |||||||||| ||||||||| ||||||||  |||| ||||||  |||||||||||||||||| || ||||| || |||||||||||||||||  ||||||    
39485917 ggtaaaaacaaaagcttattaccccaatctttttcatcctcactcaatctcctaaaatcccaagtaatcctaccagcaacaagaaaatgatctctcccat 39486016  T
113 t 113  Q
    |    
39486017 t 39486017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1318 times since January 2019
Visitors: 4413