View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0715_low_32 (Length: 209)
Name: NF0715_low_32
Description: NF0715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0715_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 6119125 - 6119318
Alignment:
Q |
1 |
cgttaaaatcatacataatcgatttcgtgttcgcgaacacgaaaaggttaccgttaggaaggagatgaacatacgggtataaattatccatttgtgtatc |
100 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6119125 |
cgttaaaatcatacataaccgatttcgtgttcgcgaacacgaaaagtttaccgttaggaaggagatgaacatacgggtataaattatccatttgtgtatc |
6119224 |
T |
 |
Q |
101 |
ttcagtttcttgcagaaacggaaacaaaacgacaccattttcacgtttcgggtaaaattcaactgtgtttgaacctcttccaccgatgatgatg |
194 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6119225 |
ttcagtttcttgtagaaacggaaacaaaacgacaccgttttcgcgtttcgggtaaaattcaactgtgtttgaacctcttccaccgatgatgatg |
6119318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University