View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0716_low_7 (Length: 218)

Name: NF0716_low_7
Description: NF0716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0716_low_7
NF0716_low_7
[»] chr4 (1 HSPs)
chr4 (48-135)||(31651892-31651979)


Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 48 - 135
Target Start/End: Original strand, 31651892 - 31651979
Alignment:
48 aatttactgatcaatagcgtccttcaattcagccgtggcttcctccgcttccttcaaggtcggaacctccccaaacaccattctcggc 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31651892 aatttactgatcaatagcgtccttcaattcagccgtggcttcctccgcttccttcaaggtcggaacctccccaaacaccattctcggc 31651979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University