View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0717_high_3 (Length: 330)

Name: NF0717_high_3
Description: NF0717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0717_high_3
NF0717_high_3
[»] chr5 (1 HSPs)
chr5 (246-330)||(732545-732629)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 246 - 330
Target Start/End: Complemental strand, 732629 - 732545
Alignment:
246 aagatttgatgatgtagagagcatttaggttggaattgttgacaggtgagccaacgcactttgcattgtgcacacaataacctat 330  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||    
732629 aagatttgatgatgtagagagcatttaggttggaattgttgacaggtgagccaacgaactttgcattgtgcacaaaataacctat 732545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University