View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0717_high_3 (Length: 330)
Name: NF0717_high_3
Description: NF0717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0717_high_3 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 246 - 330
Target Start/End: Complemental strand, 732629 - 732545
Alignment:
| Q |
246 |
aagatttgatgatgtagagagcatttaggttggaattgttgacaggtgagccaacgcactttgcattgtgcacacaataacctat |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
732629 |
aagatttgatgatgtagagagcatttaggttggaattgttgacaggtgagccaacgaactttgcattgtgcacaaaataacctat |
732545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 933 times since January 2019
Visitors: 4362