View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0717_high_6 (Length: 255)
Name: NF0717_high_6
Description: NF0717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0717_high_6 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 48 - 255
Target Start/End: Original strand, 29066378 - 29066585
Alignment:
Q |
48 |
cccaatgaacatccacttgttgcattaagcactcaaaacaacaacacaaggagtnnnnnnnnnnnnnnnnnnnatgacttgcttcttcacaaagacattc |
147 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
T |
29066378 |
cccaatgaacatccacttgttgcattaagcactcaaaacaacaacacaaggagtacacacacacacacacacaatgacttgcttcttctcaaagacattc |
29066477 |
T |
 |
Q |
148 |
attgtactattagtccttttcttgacaaattgtgtatacattgaagctcaaaaatgcaaccctaatggtatagttaaaggtaaaagtccttcagggcgtt |
247 |
Q |
|
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29066478 |
attgcactattagtccttttcttgacaaattgtctatacattgaagctcaaaaatgcaaccctaatggtatagttaaaggtaaaagtccttcagggcgtt |
29066577 |
T |
 |
Q |
248 |
gcaagcac |
255 |
Q |
|
|
|||||||| |
|
|
T |
29066578 |
gcaagcac |
29066585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University