View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0717_high_9 (Length: 201)
Name: NF0717_high_9
Description: NF0717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0717_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 18491706 - 18491528
Alignment:
Q |
1 |
tggagattggaattagaataaccgatgttagtctcgccatagaatttggattgaatcctgttttagtagcccatgaagaagattacgttgctctggtttc |
100 |
Q |
|
|
||||||||||||||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
18491706 |
tggagattggaattagagtcaccgatgttagtctcgccgtagaatttggattgaatcctgttttagtagcccatgaagaagattgcgttgctctggtttc |
18491607 |
T |
 |
Q |
101 |
aatccatggcaataccaattttggtgactctaattccagagaacacgatgtcaacttggatcttgaaacagctcatgtt |
179 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
18491606 |
aatccatggcaataccaattttggtgactctaattccagagaacacgatgtcaacttggatcttgaaacaactcatgtt |
18491528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University