View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0717_high_9 (Length: 201)

Name: NF0717_high_9
Description: NF0717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0717_high_9
NF0717_high_9
[»] chr1 (1 HSPs)
chr1 (1-179)||(18491528-18491706)


Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 18491706 - 18491528
Alignment:
1 tggagattggaattagaataaccgatgttagtctcgccatagaatttggattgaatcctgttttagtagcccatgaagaagattacgttgctctggtttc 100  Q
    ||||||||||||||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
18491706 tggagattggaattagagtcaccgatgttagtctcgccgtagaatttggattgaatcctgttttagtagcccatgaagaagattgcgttgctctggtttc 18491607  T
101 aatccatggcaataccaattttggtgactctaattccagagaacacgatgtcaacttggatcttgaaacagctcatgtt 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
18491606 aatccatggcaataccaattttggtgactctaattccagagaacacgatgtcaacttggatcttgaaacaactcatgtt 18491528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University