View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0717_low_7 (Length: 342)
Name: NF0717_low_7
Description: NF0717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0717_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 54 - 337
Target Start/End: Original strand, 7432214 - 7432497
Alignment:
| Q |
54 |
tattagagatttagttgttctatagtcgcaaaagtgtgcatta---tttgtcaaactacatgaacaaagtatgtgtctatgtgtcttgcgatattctttt |
150 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7432214 |
tattagagatttagttgttttatagtcgcaaaagtgtacattactatttgtcaaactacatgaa---agtatgtgtctatgtgtcttgcgatattctttt |
7432310 |
T |
 |
| Q |
151 |
attttatttttctatcgttcgttggtgttctaatacaatcattcgactatttagacttcgtttgaccttaattggttggtggttcattttcaactaattg |
250 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||| || |
|
|
| T |
7432311 |
attttatttttttatcgtttgttggtgttctaatacaatcattcgactatttagacttcatttgaccttaattgattggtggtttattttcaactaagtg |
7432410 |
T |
 |
| Q |
251 |
taacatatgtaatcttttttcatagctaatatttttattagatttgcttcttgttccaaattattgatccttttttctcttcatctc |
337 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
7432411 |
taacatatgtaatcttttttcatagttaatctttttattagatttgcttcttgttccaaattattgaaccttttttctcttcttctc |
7432497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University