View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_high_14 (Length: 318)
Name: NF0718_high_14
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 27 - 298
Target Start/End: Complemental strand, 12886724 - 12886453
Alignment:
| Q |
27 |
caacccaatccttctcacaatttccatatcttaaaccctacttctcttcctcctctccaccaattcttatccctcaatcctcaccatgcctcctccattg |
126 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12886724 |
caacccaatccttctcataatttccatatcttaaacccttcttctcttcctcctctccaccaattcttatccctcaatcctcaccatgcctcctccattg |
12886625 |
T |
 |
| Q |
127 |
acgctattgtttgtaccggaggctacaccgtcaatgctgatgttctccaacttctcccctccctccgtcttgtctgcacccccagcgccggaactgatca |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12886624 |
ccgctattgtttgtaccggaggctacaccgtcaacgctgatgttctccaacttctccccgccctccgtcttgtctgcacccccagcgctggaactgatca |
12886525 |
T |
 |
| Q |
227 |
tattgatctctccgagtgtcggcgtcggggaattcaggttgcaggagctggaaatcttttttctgatgatgt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12886524 |
tattgatctctccgagtgtcggcgtcggggaattcaggttgcaggagctggaaatcttttttctgaagatgt |
12886453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 203 - 286
Target Start/End: Complemental strand, 12899418 - 12899335
Alignment:
| Q |
203 |
cacccccagcgccggaactgatcatattgatctctccgagtgtcggcgtcggggaattcaggttgcaggagctggaaatctttt |
286 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||| ||||||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
12899418 |
cacctccagcgccggaactaatcacattgatctcgatgagtgtcggcgacggggaatccaggttgctaacgctggaaatctttt |
12899335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 97
Target Start/End: Complemental strand, 12899593 - 12899524
Alignment:
| Q |
28 |
aacccaatccttctcacaatttccatatcttaaaccctacttctcttcctcctctccaccaattcttatc |
97 |
Q |
| |
|
||||||| |||| |||||| ||||||||| ||||||| |||| ||||| |||||||||||||| |||| |
|
|
| T |
12899593 |
aacccaaaccttatcacaacttccatatcataaacccatcttcccttccctctctccaccaattcatatc |
12899524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University