View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_high_2 (Length: 526)
Name: NF0718_high_2
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 27693183 - 27693383
Alignment:
| Q |
1 |
ttttacagcagtccatgagagcactgtgcaaatataccaattattaataaacagatttattattctaatccataatacggtataatacaatatactacta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693183 |
ttttacagcagtccatgagagcactgtgcaaatataccaattattaataaaaagatttattattctaatccataatacggtataatacaatatactacta |
27693282 |
T |
|
| Q |
101 |
gtttggtgatcatccacagagaatgttgaatatcctaatgaatttcttgtaagttgtaattcaatggtgtttcaggagacagagtaatgcatatatattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
27693283 |
gtttggtgatcatccacagagaatgttgaatatcctaatgaatttcttgtaagttgtaattcaatggtgtttcaggagacaaagtaatgcatgtatattt |
27693382 |
T |
|
| Q |
201 |
c |
201 |
Q |
| |
|
| |
|
|
| T |
27693383 |
c |
27693383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 267 - 435
Target Start/End: Original strand, 27693449 - 27693622
Alignment:
| Q |
267 |
ccaatgcatatgatagaag-----tgtcttttaactaaatgtgtatctagtgcgnnnnnnnnnnnacttacgcaagagaatgaagagaaatagagcgcgc |
361 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| | |
|
|
| T |
27693449 |
ccaatgcatatgatagaagctaagtgtcttttaactaaatgtgtatctagtgcgtttttttttttacttacgcaagagaatgaagaaaaatagagcgccc |
27693548 |
T |
|
| Q |
362 |
actgctgtatcgtatatcatgctgcggtatgacaattgttcctcttcccggtcacggtctctgtcttgctgatg |
435 |
Q |
| |
|
| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693549 |
attgctgtatcgtatatcatgctggggtatgacaattgttcctcttcccggtcacggtctctgtcttgctgatg |
27693622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 295 times since January 2019
Visitors: 4379