View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_high_27 (Length: 254)
Name: NF0718_high_27
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0718_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 66 - 225
Target Start/End: Original strand, 14977491 - 14977650
Alignment:
Q |
66 |
gcagaaagattcatggagaacagttctaacactagcatatcaaagtcttggagtagtttatggagatttaagcatttcacctttatatgtgtttagaagt |
165 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14977491 |
gcagaaagattcatggagaacagttctaacactagcatatcaaagtcttggagtagtttatggagatttaagcatttcacctttatatgtgtttagaagt |
14977590 |
T |
 |
Q |
166 |
acttttggtgaaggaattggacactcaaatacaaatgaagagatttatggtgttttgtct |
225 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14977591 |
acttttggtgaaggaattggacactcaaatacaaatgaagagatttatggtgttttgtct |
14977650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 226
Target Start/End: Original strand, 1807871 - 1807997
Alignment:
Q |
100 |
gcatatcaaagtcttggagtagtttatggagatttaagcatttcacctttatatgtgtttagaagtacttttggtgaaggaattggacactcaaatacaa |
199 |
Q |
|
|
|||||||||||| | ||||| || |||||||||||||||| ||| || ||||||| | | ||| ||||||| ||| | |||| ||| ||| |||||| |
|
|
T |
1807871 |
gcatatcaaagtttaggagttgtgtatggagatttaagcacttctccactatatgtatacaaaagcacttttgctgaggatattgaacattcagatacaa |
1807970 |
T |
 |
Q |
200 |
atgaagagatttatggtgttttgtctt |
226 |
Q |
|
|
||||||| || | |||||| ||||||| |
|
|
T |
1807971 |
atgaagaaatctttggtgtattgtctt |
1807997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 134
Target Start/End: Original strand, 15385910 - 15385948
Alignment:
Q |
96 |
actagcatatcaaagtcttggagtagtttatggagattt |
134 |
Q |
|
|
||||||||||||||||||||| |||||||| |||||||| |
|
|
T |
15385910 |
actagcatatcaaagtcttggtgtagtttacggagattt |
15385948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 215
Target Start/End: Complemental strand, 42988527 - 42988415
Alignment:
Q |
103 |
tatcaaagtcttggagtagtttatggagatttaagcatttcacctttatatgtgtttagaagtacttttggtgaaggaattggacactcaaatacaaatg |
202 |
Q |
|
|
|||||||||||||| || || |||||||| || || ||||| || || ||||| || | ||| ||||||| ||||| |||| ||| ||| | || |||| |
|
|
T |
42988527 |
tatcaaagtcttggtgttgtatatggagacttgagtatttctccattgtatgttttcacaagcacttttgctgaagatattgaacattcagagactaatg |
42988428 |
T |
 |
Q |
203 |
aagagatttatgg |
215 |
Q |
|
|
||||||||||||| |
|
|
T |
42988427 |
aagagatttatgg |
42988415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 807 times since January 2019
Visitors: 4393