View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0718_high_27 (Length: 254)

Name: NF0718_high_27
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0718_high_27
NF0718_high_27
[»] chr5 (1 HSPs)
chr5 (66-225)||(14977491-14977650)
[»] chr6 (1 HSPs)
chr6 (100-226)||(1807871-1807997)
[»] chr2 (1 HSPs)
chr2 (96-134)||(15385910-15385948)
[»] chr3 (1 HSPs)
chr3 (103-215)||(42988415-42988527)


Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 66 - 225
Target Start/End: Original strand, 14977491 - 14977650
Alignment:
66 gcagaaagattcatggagaacagttctaacactagcatatcaaagtcttggagtagtttatggagatttaagcatttcacctttatatgtgtttagaagt 165  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14977491 gcagaaagattcatggagaacagttctaacactagcatatcaaagtcttggagtagtttatggagatttaagcatttcacctttatatgtgtttagaagt 14977590  T
166 acttttggtgaaggaattggacactcaaatacaaatgaagagatttatggtgttttgtct 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14977591 acttttggtgaaggaattggacactcaaatacaaatgaagagatttatggtgttttgtct 14977650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 226
Target Start/End: Original strand, 1807871 - 1807997
Alignment:
100 gcatatcaaagtcttggagtagtttatggagatttaagcatttcacctttatatgtgtttagaagtacttttggtgaaggaattggacactcaaatacaa 199  Q
    |||||||||||| | ||||| || |||||||||||||||| ||| ||  ||||||| |  | ||| ||||||| ||| |  |||| ||| ||| ||||||    
1807871 gcatatcaaagtttaggagttgtgtatggagatttaagcacttctccactatatgtatacaaaagcacttttgctgaggatattgaacattcagatacaa 1807970  T
200 atgaagagatttatggtgttttgtctt 226  Q
    ||||||| || | |||||| |||||||    
1807971 atgaagaaatctttggtgtattgtctt 1807997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 134
Target Start/End: Original strand, 15385910 - 15385948
Alignment:
96 actagcatatcaaagtcttggagtagtttatggagattt 134  Q
    ||||||||||||||||||||| |||||||| ||||||||    
15385910 actagcatatcaaagtcttggtgtagtttacggagattt 15385948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 215
Target Start/End: Complemental strand, 42988527 - 42988415
Alignment:
103 tatcaaagtcttggagtagtttatggagatttaagcatttcacctttatatgtgtttagaagtacttttggtgaaggaattggacactcaaatacaaatg 202  Q
    |||||||||||||| || || |||||||| || || ||||| || || ||||| || | ||| ||||||| |||||  |||| ||| ||| | || ||||    
42988527 tatcaaagtcttggtgttgtatatggagacttgagtatttctccattgtatgttttcacaagcacttttgctgaagatattgaacattcagagactaatg 42988428  T
203 aagagatttatgg 215  Q
    |||||||||||||    
42988427 aagagatttatgg 42988415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 807 times since January 2019
Visitors: 4393