View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_high_37 (Length: 216)
Name: NF0718_high_37
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 42935572 - 42935766
Alignment:
| Q |
1 |
tttcagccacatgaatctcctctccaccaattagattcattagaaacttaacttgtcccaactcttgttccaagctctctttcaacacattcaacgttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935572 |
tttcagccacatgaatctcctctccaccaattagattcattagaaacttaacttgtcccaactcttgttccaagctctctttcaacacattcaacgttgc |
42935671 |
T |
|
| Q |
101 |
caacgtagcttcgcggttcttaacaacaccaccaacattttcatgatca---acatcagtagtattggtctttggctccatcacagttcctgatg |
192 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935672 |
caacgtagcttcacggttcttaacaacaccaccgacattttcatgatcaaccacatcagaagtattggtctttggctccatcacagttcctgatg |
42935766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 58 times since January 2019
Visitors: 4369