View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0718_low_24 (Length: 375)

Name: NF0718_low_24
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0718_low_24
NF0718_low_24
[»] chr8 (1 HSPs)
chr8 (30-332)||(13262397-13262699)


Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 30 - 332
Target Start/End: Original strand, 13262397 - 13262699
Alignment:
30 cttcaccgcgaagaaatccatgcgcgatgagcttctgaatcgcatcaacggtgggttcggctattttgctgacaccggagctagcggcattgatgagagg 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||    
13262397 cttcaccgcgaagaaatccatgcgcgatgagcttctgaatcgcatcaacggcgggttcggctattttgctgacgccggagctagcggcattgatgagagg 13262496  T
130 aagaagaatggattcggattcggttagcgagaattccaccggtccaccatcgtgaagcggaccgggcgtttccggttcggtatcggagggtgaaccggga 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13262497 aagaagaatggattcggattcggttagcgagaattccaccggtccaccatcgtgaagcggaccgggcgtttccggttcggtatcggagggtgaaccggga 13262596  T
230 attgttctgttgtcagtgttactgagtctgtcgataatggatttgcattcgtgagcgagttttgcgtgttttcgccatgaagcgtggttgatgattttgt 329  Q
    |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13262597 attgttctgttgtcagtgttactgagtctgtcaatgatggatttgcattcgtgagcgagttttgcgtgttttcgccatgaagcgtggttgatgattttgt 13262696  T
330 tga 332  Q
    |||    
13262697 tga 13262699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1052 times since January 2019
Visitors: 4363