View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_low_24 (Length: 375)
Name: NF0718_low_24
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 30 - 332
Target Start/End: Original strand, 13262397 - 13262699
Alignment:
| Q |
30 |
cttcaccgcgaagaaatccatgcgcgatgagcttctgaatcgcatcaacggtgggttcggctattttgctgacaccggagctagcggcattgatgagagg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13262397 |
cttcaccgcgaagaaatccatgcgcgatgagcttctgaatcgcatcaacggcgggttcggctattttgctgacgccggagctagcggcattgatgagagg |
13262496 |
T |
 |
| Q |
130 |
aagaagaatggattcggattcggttagcgagaattccaccggtccaccatcgtgaagcggaccgggcgtttccggttcggtatcggagggtgaaccggga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13262497 |
aagaagaatggattcggattcggttagcgagaattccaccggtccaccatcgtgaagcggaccgggcgtttccggttcggtatcggagggtgaaccggga |
13262596 |
T |
 |
| Q |
230 |
attgttctgttgtcagtgttactgagtctgtcgataatggatttgcattcgtgagcgagttttgcgtgttttcgccatgaagcgtggttgatgattttgt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13262597 |
attgttctgttgtcagtgttactgagtctgtcaatgatggatttgcattcgtgagcgagttttgcgtgttttcgccatgaagcgtggttgatgattttgt |
13262696 |
T |
 |
| Q |
330 |
tga |
332 |
Q |
| |
|
||| |
|
|
| T |
13262697 |
tga |
13262699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University