View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_low_33 (Length: 324)
Name: NF0718_low_33
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 42935596 - 42935391
Alignment:
| Q |
1 |
ggagaggagattcatgtggctgaaagtgatgagaaaatggtgcaagagatctctaagttgaggacagaattggaaaatgagaagaagaagaacttgcagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935596 |
ggagaggagattcatgtggctgaaagtgatgagaaaatggtgcaagagatctctaagttgaggacagaattggaaaatgagaagaagaagaacttgcagc |
42935497 |
T |
 |
| Q |
101 |
tggagatgcagctggagaatatcaagcttcacctaatttcctctgctgctaatagtcctactagttagttaacttgataatatgtgtttctacataatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42935496 |
tggagatgcagctggagaatatcaagcttcacctaatttcctctgctgctaatagtcctactagttaattaacttgataatatgtgtttctacataatat |
42935397 |
T |
 |
| Q |
201 |
ctctga |
206 |
Q |
| |
|
|||||| |
|
|
| T |
42935396 |
ctctga |
42935391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 248 - 295
Target Start/End: Complemental strand, 42935391 - 42935344
Alignment:
| Q |
248 |
atatgttgtatttcttaaagttagatactctactggagatgtgcaaca |
295 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
42935391 |
atatgttgtatttcttaaatttagatactctaccggagatgtgcaaca |
42935344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University