View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_low_50 (Length: 286)
Name: NF0718_low_50
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0718_low_50 |
 |  |
|
[»] scaffold0048 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0048 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 21 - 274
Target Start/End: Complemental strand, 74830 - 74577
Alignment:
Q |
21 |
acatcatcactatataaatcgaattaatttcataactcaatgtagtatatgttggcttcttttagacctacaaatatcttaataataaaatgaaatacat |
120 |
Q |
|
|
|||||||||| ||||||||| ||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
T |
74830 |
acatcatcacaatataaatcaaattaatttcacaactcaaagtaatatatgttggcttcttttagacctacaaatatcataataataaaatgaaatatat |
74731 |
T |
 |
Q |
121 |
annnnnnnnnatcaatatccaataaattggttcaagaacatattattagactcgacctacatatccctacaccaaagcatataacccaatctaaacataa |
220 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||| |
|
|
T |
74730 |
atttttttttatcaatatccaataaattggttcaagaacatattattagactcgaccttcatgtcccaacaccaaagcatataacccaatctaaacataa |
74631 |
T |
 |
Q |
221 |
acaatagtctaaacaacttttgagaacaatataacatagattataataattctc |
274 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
T |
74630 |
acaatagtctaaacaacttttgagaacaaaataacatagattacaataattctc |
74577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 151 times since January 2019
Visitors: 4370