View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_low_53 (Length: 277)
Name: NF0718_low_53
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_low_53 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 36 - 228
Target Start/End: Complemental strand, 30147796 - 30147604
Alignment:
| Q |
36 |
gataattggagtttggagattggagagggcgttaatgaaaggatagtttccagtgttaccgacatgacggatattttctgcatcttgaggtatttttggg |
135 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30147796 |
gataattggactttggagattggaaagggcgttaatgaaaggatagtttccagtgttaccgacatgacggatattttctgcatcttgaggtatttttggg |
30147697 |
T |
|
| Q |
136 |
tgtgaagggaaagggagaatgagtgtttggatggtgtttgggtgagttgataagagagggtttagtatagggaggtttttaggggtgatgatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30147696 |
tgtgaagggaaagggagaatgagtgtttggatggtgtttgggtgagttgataagagagggtttagtatagggagatttttaggggtgatgatg |
30147604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 47 - 228
Target Start/End: Original strand, 141823 - 142004
Alignment:
| Q |
47 |
tttggagattggagagggcgttaatgaaaggatagtttccagtgttaccgacatgacggatattttctgcatcttgaggtatttttgggtgtgaagggaa |
146 |
Q |
| |
|
|||| |||||||| || ||||||||||||||||||||||| | ||| |||| | ||||| |||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
141823 |
tttgaagattggaaagtgcgttaatgaaaggatagtttccggggtttccgatttcacggagattttcaacatctgagggtattttggggtgtgaagggaa |
141922 |
T |
|
| Q |
147 |
agggagaatgagtgtttggatggtgtttgggtgagttgataagagagggtttagtatagggaggtttttaggggtgatgatg |
228 |
Q |
| |
|
|||| || ||||||| ||| ||||||||||| ||||| || |||||| ||| || |||||||||||||| |||| |||| |
|
|
| T |
141923 |
tgggaagattagtgttttgattgtgtttgggtgtgttgacaaaagaggggttaagatggggaggtttttaggagtgacgatg |
142004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 618 times since January 2019
Visitors: 4387