View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_low_55 (Length: 276)
Name: NF0718_low_55
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_low_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 38359026 - 38359146
Alignment:
| Q |
1 |
aaattagaaatgagtaatcccccgaaggagatttgtttatcgtcaactccatcctaatttacaactattcattcatctccagaagagaaatttgctttag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38359026 |
aaattagaaatgagtaatcccccgaaggagatttgtttatcatcaactccatcctaatttacaactattcattcatctccagaagaaaaatttgctttag |
38359125 |
T |
|
| Q |
101 |
gaacaaaaataaacgaaaatt |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38359126 |
gaacaaaaataaacgaaaatt |
38359146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 139 - 223
Target Start/End: Original strand, 38359216 - 38359302
Alignment:
| Q |
139 |
tgatttgtatcatcatttgctgccctcatcattagtcacagacactttta--atttttgttttgtttcaaatagttcagtggttatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| || |||||| |||||||||||||||| |||||| |||| |
|
|
| T |
38359216 |
tgatttgtatcatcatttgctgccctcatcattagtcacaggcacttataatattttttttttgtttcaaatagtccagtggctatt |
38359302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1021 times since January 2019
Visitors: 4400