View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0718_low_64 (Length: 260)

Name: NF0718_low_64
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0718_low_64
NF0718_low_64
[»] chr1 (1 HSPs)
chr1 (22-223)||(41954915-41955110)


Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 22 - 223
Target Start/End: Complemental strand, 41955110 - 41954915
Alignment:
22 gagaggttggatagcaaaagctcgaggggatgaacttcactacagaacccatctcttcatgtgaaccccatcaaaataataatatgtttgtaggtcctac 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41955110 gagaggttggatagcaaaagctcgaggggatgaacttcactacagaacccatctcttcatgtgaaccccatcaaaataataatatgtttgtaggtcctac 41955011  T
122 ctcacatacacaacccatgactcaaacaaaaacaaacactatatatcggggatgcatcagtacttttctactcgagaaatcttacggaatgaattatttt 221  Q
    ||||||||||||||||||||||||||      ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
41955010 ctcacatacacaacccatgactcaaa------caaacactatatatcggggatgcatgagtacttttctactcgagaaatcttacggaatgaattatttt 41954917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1384 times since January 2019
Visitors: 4413