View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0718_low_71 (Length: 252)

Name: NF0718_low_71
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0718_low_71
NF0718_low_71
[»] chr8 (1 HSPs)
chr8 (224-252)||(14740323-14740351)


Alignment Details
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 224 - 252
Target Start/End: Complemental strand, 14740351 - 14740323
Alignment:
224 gacattacccagcaacaagacgataacca 252  Q
    |||||||||||||||||||||||||||||    
14740351 gacattacccagcaacaagacgataacca 14740323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University