View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_low_73 (Length: 251)
Name: NF0718_low_73
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0718_low_73 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 251
Target Start/End: Original strand, 10598818 - 10599049
Alignment:
Q |
20 |
gacatcatcaggtttcacacctgttttgagcatatcatagaacaattctagtgcttttgtagcaaacccatgttttgcaaaaccatttatgatagaggtc |
119 |
Q |
|
|
|||||||| ||| ||||||||||||| ||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
10598818 |
gacatcattaggcttcacacctgtttcaagcatattatagaacaattctagtgcttttgaagcaaatccatgttttgcaaaaccatttatgatagaggtc |
10598917 |
T |
 |
Q |
120 |
caagttatgacattgcgatcttccatgtcattaaagacctgtaaagcagcttctttgtttccacacttagaatacatagagatcaaagcattattaacac |
219 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
10598918 |
caagttatgacattgcaatcttccatgtcattaaagacctgtaaagcagcttctttgtttccacacttggaatacatagagatcaaagcattattaacac |
10599017 |
T |
 |
Q |
220 |
ttaggtcagtccgaaatcccatcttcaccacc |
251 |
Q |
|
|
||| ||||||||||||||| ||||| |||||| |
|
|
T |
10599018 |
ttaagtcagtccgaaatccaatcttaaccacc |
10599049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University