View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_low_78 (Length: 249)
Name: NF0718_low_78
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_low_78 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 124 - 249
Target Start/End: Original strand, 51808109 - 51808231
Alignment:
| Q |
124 |
aataacaagtcacaatccagattgataataataatagagaaagnnnnnnnnnttacccagtccaacttctttcaaaaacattgactataattttgnnnnn |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51808109 |
aataacaagtcacaatccagattgataataataatagagaaa--aaaaaaaattacccagtccaacttctttcaaaaacattgactataattttg-tttt |
51808205 |
T |
 |
| Q |
224 |
nnnataaaagtcaacaaacacaccaa |
249 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
51808206 |
tttataaaagtcaacaaacacaccaa |
51808231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 51808015 - 51808064
Alignment:
| Q |
30 |
gatgccttcttagatctatatttcgaaggaaagccatgtttggaaaaatc |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51808015 |
gatgccttcttagatctatatttcgaaggaaagccatgtttggaaaaatc |
51808064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University