View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_low_79 (Length: 248)
Name: NF0718_low_79
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_low_79 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 192883 - 193108
Alignment:
| Q |
1 |
gtcacaagtaaattgatttaaacaggatgccatctttatccttacgaccaaaatgaggaatttgttacatgagaaaaggnnnnnnnnn-ctacttcctaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
192883 |
gtcacaagtaaattgatttaaacaggatgccatcttcatcctcacaaccaaaatgaggaatttgttacatgagaaaaggaaaaaaaaaactacttcctaa |
192982 |
T |
|
| Q |
100 |
ggaaggagacgtttggggcatctacaacgatgcaaagaaaatagcatgataaggctcatgcaatcaagcaagagactcgaaacttttatttcccaacatg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
192983 |
ggaaggagacgtttggggcatctacaacgatgcaaagaaaatagcatgataaggctcatgcaatcgagcaagagactcaaaacttttatttcccaacatg |
193082 |
T |
|
| Q |
200 |
cattcacttcttgaagaatatgatga |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
193083 |
cattcacttcttgaagaatatgatga |
193108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 89 - 225
Target Start/End: Original strand, 189039 - 189175
Alignment:
| Q |
89 |
ctacttcctaaggaaggagacgtttggggcatctacaacgatgcaaagaaaatagcatgataaggctcatgcaatcaagcaagagactcgaaacttttat |
188 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
189039 |
ctacttcctaagggaggagacgtctagggcatctacaacgatgcaaagaaaatagcatgacaaagctcatgcaattgagcaagagactcgaaacttctat |
189138 |
T |
|
| Q |
189 |
ttcccaacatgcattcacttcttgaagaatatgatga |
225 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
189139 |
ttcccaacatccattcacttcttgaagaatatgatga |
189175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 113 times since January 2019
Visitors: 4370