View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_low_80 (Length: 248)
Name: NF0718_low_80
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_low_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 192907 - 192687
Alignment:
| Q |
1 |
ctgtttaaatcaatttacttgtgacatatcattttggtatgagcttatgggatttcatcctttagtctgtagagatcatttggatttggaacaaggtttc |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
192907 |
ctgtttaaatcaatttacttgtgacgtatcattttggtatgagcttatgtgatttcatcctttagtctgtagagatcatttggatttggaacaaggtttc |
192808 |
T |
 |
| Q |
101 |
atactgttaacacttgttg-tgtagatagagttttgttatcattatctcaattcaatattgttctattctgacttgattgattaatatttgctatatttg |
199 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
192807 |
atactgttaacacttgttgttgtagatagagttttgttatcattatctcaattcaatattgttctattctgacttgattgattaatatttgctatatttg |
192708 |
T |
 |
| Q |
200 |
agaaattatgatcgtgttgtt |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
192707 |
agaaattatgatcgtgttgtt |
192687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University