View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_low_83 (Length: 237)
Name: NF0718_low_83
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_low_83 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 24 - 196
Target Start/End: Original strand, 192789 - 192961
Alignment:
| Q |
24 |
caacaaatgataacagtattaaaccttgttccaaatccaaatgatctctacagactaaaggatgaaatcccataagctcataccaaaatgatatgtcaca |
123 |
Q |
| |
|
|||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
192789 |
caacaagtgttaacagtatgaaaccttgttccaaatccaaatgatctctacagactaaaggatgaaatcacataagctcataccaaaatgatacgtcaca |
192888 |
T |
|
| Q |
124 |
agtaaattgatttaaacaggatgccatctttatccttacgaccaaaatgaggaatttgttacatgagaaaagg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
192889 |
agtaaattgatttaaacaggatgccatcttcatcctcacaaccaaaatgaggaatttgttacatgagaaaagg |
192961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1401 times since January 2019
Visitors: 4368