View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0718_low_85 (Length: 233)

Name: NF0718_low_85
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0718_low_85
NF0718_low_85
[»] chr8 (1 HSPs)
chr8 (4-219)||(43535433-43535648)


Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 4 - 219
Target Start/End: Original strand, 43535433 - 43535648
Alignment:
4 cacctccgccggagtctttcaaagctttactacatggaattctacggcgaagagttgaagaggttttgtagagatggggaaaggtaggatgagagcgtgg 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43535433 cacctccgccggagtctttcaaagctttactacatggaattctacggcgaagagttgaagaggttttgtagagatggggaaaggtaggatgagagcgtgg 43535532  T
104 tggtgaagagagtcttcttgaattaaaatggaatttagggaatttgattggattgaagagatgagcatggttggagtttggggtttgaagtgaagggaag 203  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43535533 tggagaagagagtcttcttgaattaaaatggaatttagggaatttgattggattgaagagatgagcatggttggagtttggggtttgaagtgaagggaag 43535632  T
204 atagagaatgatgatg 219  Q
    ||||||||||||||||    
43535633 atagagaatgatgatg 43535648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 357 times since January 2019
Visitors: 4379