View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_low_90 (Length: 208)
Name: NF0718_low_90
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_low_90 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 17182277 - 17182085
Alignment:
| Q |
1 |
gaccagtatcagagattaaaaacatttccaatctctatgtgtcttgtgcaagtgcttcataaactgtaactcttattcctggtttctaatgtagggggac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17182277 |
gaccagtatcagagattaaaaacatttccaatctctatgtgtcttgtgcaagtgcttcataaactgtaactcttattcctggtttctaatgtagggggac |
17182178 |
T |
 |
| Q |
101 |
catcatttctagggaagagatctatgtcattttcatcaggtattgaacttggagaagaagcaaatatacctgaggaagatttatctgatgatg |
193 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17182177 |
catcatttctagggaagagatgtatgtcattttcatcggggattgaacttggagaagaagcaaatatacctgaggaagatttatctgatgatg |
17182085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University