View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0718_low_91 (Length: 206)
Name: NF0718_low_91
Description: NF0718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0718_low_91 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 76 - 183
Target Start/End: Complemental strand, 34695344 - 34695237
Alignment:
| Q |
76 |
gttttcaaatattcatctttaattgaaattatttaccacttaagttcaatcactttataaaaatgaatatttattaccttgaaattgatcaccagtaaag |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34695344 |
gttttcaaatattcatctttaattgaaattatttaccacttaagttcaatcactttataaaaattaatatttattaccttgaaattgatcaccagtaaag |
34695245 |
T |
 |
| Q |
176 |
aggaatgg |
183 |
Q |
| |
|
|||||||| |
|
|
| T |
34695244 |
aggaatgg |
34695237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 34697148 - 34697071
Alignment:
| Q |
1 |
tataggaaatttagagtttgacacataagtaaagtttgatnnnnnnnttgttcaaactaggatttaaatcagtttgtt |
78 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
34697148 |
tataggtaatttagagtttgacacataagtaaagtttgataaaaaaattgttaaaactaggatttaaatcagtttgtt |
34697071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University