View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_high_11 (Length: 313)
Name: NF0719_high_11
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0719_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 14 - 287
Target Start/End: Original strand, 45127025 - 45127298
Alignment:
| Q |
14 |
ggacatcatcggctacggtgaagttcatcatcagcagcatcatgtttgttggatttggaactgcatgcgttttttattccattcaagtgttcatctgaga |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45127025 |
ggacaacatcggctacggtgaagttcatcatcagcagcatcatgtttgttggatttggaactgcatgcgtttttgattccattcaagtgttcatctgaga |
45127124 |
T |
|
| Q |
114 |
gacttaaagggcatcttgcaacatcagcttgttcaggaaaggcagggattgttccttttgaagatgaagatggatttggtgtgagtggttgaactgttgc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45127125 |
gacttaaagggcatcttgcaacatcagcttgttcaggaaaggcagggattgttccttgtaaagatgaagatggatttggtgtgagtggttgaactgttgc |
45127224 |
T |
|
| Q |
214 |
tgcatcagggatagggatagtgataggtagagacagatagcaaggaatgaataagatgagaagaagggtattga |
287 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45127225 |
tgcatcagggatagggatagggataggtagagacagatagcaaggaatgaataagatgagaagaagggtattga |
45127298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1651 times since January 2019
Visitors: 4426